Regions module¶
Module for handling genomic regions such as chromosomes, bins, and restriction fragments.
The class RegionsTable is an implementation of the RegionBased
interface from the genomic_regions package. More details on how to use the
RegionBased interface can be found in the genomic_regions
documentation, but here is an example to get you started:
import fanc
rt = fanc.RegionsTable()
# demo how to add regions
regions = []
for chromosome in ['chr1', 'chr2']:
for start in range(1, 10000, 1000):
r = fanc.GenomicRegion(chromosome=chromosome, start=start, end=start+999)
regions.append(r)
rt.add_regions(regions)
# query regions on chromosome 1
for r in rt.regions('chr1'):
print(r) # chr1:1-1000, chr1:1001-2000, ..., chr1:9001-10000
The class Chromosome holds chromosome information, specifically the
chromosome name in the reference genome, its length in base pairs, and its DNA
sequence. Multiple Chromosome objects can be grouped into a Genome,
which provides convenient access to its chromosomes and has useful functions for
in silico digestion and genome binning.
import fanc
# create chromosomes
chromosome1 = fanc.Chromosome(name='chr1', sequence='AAGTCCGTGCTGTCGATCATAGCTAGCTAGCTA')
chromosome2 = fanc.Chromosome(name='chr2', sequence='GTGTCGATCAAATCGAAA')
len(chromosome1) # 33
# create genome
genome = fanc.Genome()
genome.add_chromosome(chromosome1)
genome.add_chromosome(chromosome2)
# in silico digestion
restriction_fragments = genome.get_regions('MboI') # cuts 'GATC'
for r in restriction_fragments.regions:
print(r) # chr1:1-15, chr1:16-33, chr2:1-6, chr2:7-18
# binning
bins = genome.get_regions(10) # cuts 'GATC'
for r in bins.regions:
print(r) # chr1:1-10, chr1:11-20, chr1:21-30, chr1:31-33, chr2:1-10, chr2:11-18
# load genome from file
genome_from_file = Genome.from_string("hg19_chr18_19.fa")
genome_from_file.chromosomes() # ['chr18', 'chr19']
-
class
fanc.regions.Chromosome(name=None, length=None, sequence=None)¶ Bases:
objectChromosome data type.
-
name¶ Name of the chromosome
-
length¶ Length of the chromosome in base-pairs
-
sequence¶ Base-pair sequence of DNA in the chromosome
-
classmethod
from_fasta(file_name, name=None, include_sequence=True)¶ Create a
Chromosomefrom a FASTA file.This class method will load a FASTA file and convert it into a
Chromosomeobject. If the FASTA file contains multiple sequences, the output will be a list ofChromosomeobjects.Parameters: - file_name – Path to the FASTA file
- name – Chromosome name. If None (default), will be read from the FASTA file header
- include_sequence – If True (default), stores the chromosome sequence in memory. Else, the sequence attribute will be set to None.
Returns: Chromosomeif there is only a single FASTA sequence in the file, list(Chromosome) if there are multiple sequences.
-
get_restriction_sites(restriction_enzyme)¶ Find the restriction sites of a provided enzyme in this chromosome.
Internally uses Biopython to find RE sites.
Parameters: restriction_enzyme – The name of the restriction enzyme (e.g. HindIII) Returns: List of RE sites in base-pairs (1-based)
-
-
class
fanc.regions.Genome(file_name=None, chromosomes=None, mode='a', tmpdir=None, _table_name_chromosomes='chromosomes')¶ Bases:
fanc.general.FileGroupClass representing a collection of chromosomes.
Provides some convenience batch methods that call
Chromosomemethods for every chromosome in this object.-
class
ChromosomeDefinition¶ Bases:
tables.description.IsDescription
-
add_chromosome(chromosome)¶ Add a
Chromosometo this object.Will choose suitable defaults for missing attributes.
Parameters: chromosome – Chromosomeobject or similar object (e.g. dict) with the same fields
-
chromosomes()¶ Get list of chromosomes in this object
-
close(copy_tmp=True, remove_tmp=True)¶ Close this HDF5 file and run exit operations.
If file was opened with tmpdir in read-only mode: close file and delete temporary copy.
If file was opened with tmpdir in write or append mode: Replace original file with copy and delete copy.
Parameters: - copy_tmp – If False, does not overwrite original with modified file.
- remove_tmp – If False, does not delete temporary copy of file.
-
classmethod
from_folder(folder_name, file_name=None, exclude=None, include_sequence=True, tmpdir=None)¶ Load every FASTA file from a folder as a chromosome.
Parameters: - folder_name – Path to the folder to load
- file_name – File to save Genome object to
- exclude – List or set of chromosome names that should NOT be loaded
- include_sequence – If True, will save the chromosome sequences in the Genome object
-
classmethod
from_string(genome_string, file_name=None, tmpdir=None, mode='a')¶ Convenience function to load a
Genomefrom a string.Parameters: - genome_string – Path to FASTA file, path to folder with FASTA files, comma-separated list of paths to FASTA files, path to HDF5 file
- file_name – Path to save file
Returns: A
Genomeobject
-
get_regions(split, file_name=None, chromosomes=None)¶ Extract genomic regions from genome.
Provides two options:
- Splits chromosomes at restriction sites if the split parameter is the name of a restriction enzyme.
- Splits chromosomes at equi-distant points if split is an integer
Parameters: - split – Name of a restriction enzyme or positive integer
- file_name – Name of a file if the result of this method should be saved to file
- chromosomes – List of chromosome names to include. Default: all
Returns: GenomicRegions
-
sub_sequence(chromosome, start=None, end=None)¶ Extract the chromosome DNA sequence between start and end.
Parameters: - chromosome – Name of chromosome
- start – start position in bp (1-based, inclusive)
- end – end position in bp (1-based, inclusive)
Returns: str
-
class
-
class
fanc.regions.RegionsTable(file_name=None, mode='a', tmpdir=None, additional_fields=None, _table_name_regions='regions')¶ Bases:
fanc.regions.RegionBasedWithBins,fanc.general.FileGroupPyTables Table wrapper for storing genomic regions.
This class is inherited by objects working with lists of genomic regions, such as equidistant bins along chromosomes in a genome (
Hic) or restriction fragments of genomic DNA (ReadPairs)Internally, each genomic region is encoded in a PyTables Table and the following region attributes are represented as table columns: ix, chromosome, start, end, and strand. To add additional region attributes, such as a score, use the “additional_fields” parameter of the __init__ method. This must be a dict where the keys are str and values are PyTables column descriptors, such as
StringCol. Example for adding a score field:import fanc import tables rt = fanc.RegionsTable( additional_fields={'score': tables.Float32Col()} )
-
class
ChromosomeDescription¶ Bases:
tables.description.IsDescriptionDescription of the chromosomes in this object.
-
class
RegionDescription¶ Bases:
tables.description.IsDescriptionDescription of a genomic region for PyTables Table
-
add_region(region, *args, **kwargs)¶ Add a genomic region to this object.
This method offers some flexibility in the types of objects that can be loaded. See parameters for details.
Parameters: region – Can be a GenomicRegion, a str in the form ‘<chromosome>:<start>-<end>[:<strand>], a dict with at least the fields ‘chromosome’, ‘start’, and ‘end’, optionally ‘ix’, or a list of length 3 (chromosome, start, end) or 4 (ix, chromosome, start, end).
-
add_regions(regions, *args, **kwargs)¶ Bulk insert multiple genomic regions.
Parameters: regions – List (or any iterator) with objects that describe a genomic region. See add_regionfor options.
-
static
bin_intervals(intervals, bins, interval_range=None, smoothing_window=None, nan_replacement=None, zero_to_nan=False)¶ Bin a given set of intervals into a fixed number of bins.
Parameters: - intervals – iterator of tuples (start, end, score)
- bins – Number of bins to divide the region into
- interval_range – Optional. Tuple (start, end) in base pairs of range of interval to be binned. Useful if intervals argument does not cover to exact genomic range to be binned.
- smoothing_window – Size of window (in bins) to smooth scores over
- nan_replacement – NaN values in the scores will be replaced with this value
- zero_to_nan – If True, will convert bins with score 0 to NaN
Returns: iterator of tuples: (start, end, score)
-
static
bin_intervals_equidistant(intervals, bin_size, interval_range=None, smoothing_window=None, nan_replacement=None, zero_to_nan=False)¶ Bin a given set of intervals into bins with a fixed size.
Parameters: - intervals – iterator of tuples (start, end, score)
- bin_size – Size of each bin in base pairs
- interval_range – Optional. Tuple (start, end) in base pairs of range of interval to be binned. Useful if intervals argument does not cover to exact genomic range to be binned.
- smoothing_window – Size of window (in bins) to smooth scores over
- nan_replacement – NaN values in the scores will be replaced with this value
- zero_to_nan – If True, will convert bins with score 0 to NaN
Returns: iterator of tuples: (start, end, score)
-
bin_size¶ Return the length of the first region in the dataset.
Assumes all bins have equal size.
Returns: int
-
binned_regions(region=None, bins=None, bin_size=None, smoothing_window=None, nan_replacement=None, zero_to_nan=False, *args, **kwargs)¶ Same as region_intervals, but returns
GenomicRegionobjects instead of tuples.Parameters: - region – String or class:~GenomicRegion object denoting the region to be binned
- bins – Number of bins to divide the region into
- bin_size – Size of each bin (alternative to bins argument)
- smoothing_window – Size of window (in bins) to smooth scores over
- nan_replacement – NaN values in the scores will be replaced with this value
- zero_to_nan – If True, will convert bins with score 0 to NaN
- args – Arguments passed to _region_intervals
- kwargs – Keyword arguments passed to _region_intervals
Returns: iterator of
GenomicRegionobjects
-
bins_to_distance(bins)¶ Convert fraction of bins to base pairs
Parameters: bins – float, fraction of bins Returns: int, base pairs
-
chromosome_bins¶ Returns a dictionary of chromosomes and the start and end index of the bins they cover.
Returned list is range-compatible, i.e. chromosome bins [0,5] cover chromosomes 1, 2, 3, and 4, not 5.
-
chromosome_lengths¶ Returns a dictionary of chromosomes and their length in bp.
-
chromosomes()¶ List all chromosomes in this regions table. :return: list of chromosome names.
-
close(copy_tmp=True, remove_tmp=True)¶ Close this HDF5 file and run exit operations.
If file was opened with tmpdir in read-only mode: close file and delete temporary copy.
If file was opened with tmpdir in write or append mode: Replace original file with copy and delete copy.
Parameters: - copy_tmp – If False, does not overwrite original with modified file.
- remove_tmp – If False, does not delete temporary copy of file.
-
distance_to_bins(distance)¶ Convert base pairs to fraction of bins.
Parameters: distance – distance in base pairs Returns: float, distance as fraction of bin size
-
find_region(query_regions, _regions_dict=None, _region_ends=None, _chromosomes=None)¶ Find the region that is at the center of a region.
Parameters: query_regions – Region selector string, :class:~GenomicRegion, or list of the former Returns: index (or list of indexes) of the region at the center of the query region
-
flush()¶ Write buffered data to file.
-
intervals(*args, **kwargs)¶ Alias for region_intervals.
-
region_bins(*args, **kwargs)¶ Return slice of start and end indices spanned by a region.
Parameters: args – provide a GenomicRegionhere to get the slice of start and end bins of onlythis region. To get the slice over all regions leave this blank.Returns:
-
region_data(key, value=None)¶ Retrieve or add vector-data to this object. If there is existing data in this object with the same name, it will be replaced
Parameters: - key – Name of the data column
- value – vector with region-based data (one entry per region)
-
region_intervals(region, bins=None, bin_size=None, smoothing_window=None, nan_replacement=None, zero_to_nan=False, score_field='score', *args, **kwargs)¶ Return equally-sized genomic intervals and associated scores.
Use either bins or bin_size argument to control binning.
Parameters: - region – String or class:~GenomicRegion object denoting the region to be binned
- bins – Number of bins to divide the region into
- bin_size – Size of each bin (alternative to bins argument)
- smoothing_window – Size of window (in bins) to smooth scores over
- nan_replacement – NaN values in the scores will be replaced with this value
- zero_to_nan – If True, will convert bins with score 0 to NaN
- args – Arguments passed to _region_intervals
- kwargs – Keyword arguments passed to _region_intervals
Returns: iterator of tuples: (start, end, score)
-
region_subset(region, *args, **kwargs)¶ Takes a class:~GenomicRegion and returns all regions that overlap with the supplied region.
Parameters: region – String or class:~GenomicRegion object for which covered bins will be returned.
-
regions¶ Iterate over genomic regions in this object.
Will return a
GenomicRegionobject in every iteration. Can also be used to get the number of regions by calling len() on the object returned by this method.Returns: RegionIter
-
regions_dict¶ Return a dictionary with region index as keys and regions as values.
Returns: dict {region.ix: region, …}
-
to_bed(file_name, subset=None, **kwargs)¶ Export regions as BED file
Parameters: - file_name – Path of file to write regions to
- subset – optional
GenomicRegionor str to write only regions overlapping this region - kwargs – Passed to
write_bed()
-
to_bigwig(file_name, subset=None, **kwargs)¶ Export regions as BigWig file.
Parameters: - file_name – Path of file to write regions to
- subset – optional
GenomicRegionor str to write only regions overlapping this region - kwargs – Passed to
write_bigwig()
-
to_gff(file_name, subset=None, **kwargs)¶ Export regions as GFF file
Parameters: - file_name – Path of file to write regions to
- subset – optional
GenomicRegionor str to write only regions overlapping this region - kwargs – Passed to
write_gff()
-
class
-
class
fanc.regions.LazyGenomicRegion(row, ix=None, auto_update=True)¶ Bases:
genomic_regions.regions.GenomicRegionA
GenomicRegionobject with lazy attribute loading.This class is central to an efficient retrieval of regions from objects subclassing
RegionsTable. Its handling should be mostly identical toGenomicRegion, but attributes will only be loaded on demand. Changes to attributes will change the underlying row in the HDF5 regions table if the auto_update parameter is set to True (default). Else you can manually callupdate().-
as_bed_line(score_field='score', name_field='name')¶ Return a representation of this object as line in a BED file.
Parameters: - score_field – name of the attribute to be used in the ‘score’ field of the BED line
- name_field – name of the attribute to be used in the ‘name’ field of the BED line
Returns: str
-
as_gff_line(source_field='source', feature_field='feature', score_field='score', frame_field='frame', float_format='.2e')¶ Return a representation of this object as line in a GFF file.
Parameters: - source_field – name of the attribute to be used in the ‘source’ field of the GFF line
- feature_field – name of the attribute to be used in the ‘feature’ field of the GFF line
- score_field – name of the attribute to be used in the ‘score’ field of the GFF line
- frame_field – name of the attribute to be used in the ‘frame’ field of the GFF line
- float_format – Formatting string for the float fields
Returns: str
-
attributes¶ List of all attributes in this region.
-
center¶ Return the center coordinate of the
GenomicRegion.Returns: float
-
contains(region)¶ Check if the specified region is completely contained in this region.
Parameters: region – GenomicRegionobject or string
-
copy()¶ Return a (shallow) copy of this
GenomicRegionReturns: GenomicRegion
-
expand(absolute=None, relative=None, absolute_left=0, absolute_right=0, relative_left=0.0, relative_right=0.0, copy=True, from_center=False)¶ Expand this region by a relative or an absolute amount.
Parameters: - absolute – Absolute amount in base pairs by which to
expand the region represented by this
GenomicRegionobject on both sides. New region start will be <old start - absolute>, new region end will be <old end + absolute> - relative – Relative amount as fraction of region by which to
expand the region represented by this
GenomicRegionobject on both sides. New region start will be <old start - relative*len(self)>, new region end will be <old end + relative*(len(self)> - absolute_left – Absolute amount in base pairs by which to
expand the region represented by this
GenomicRegionobject on the left side - absolute_right – Absolute amount in base pairs by which to
expand the region represented by this
GenomicRegionobject on the right side - relative_left – Relative amount in base pairs by which to
expand the region represented by this
GenomicRegionobject on the left side - relative_right – Relative amount in base pairs by which to
expand the region represented by this
GenomicRegionobject on the right side - copy – If True, return a copy of the original region, if False will modify the existing region in place
- from_center – If True measures distance from center rather than start and end of the old region
Returns: GenomicRegion- absolute – Absolute amount in base pairs by which to
expand the region represented by this
-
five_prime¶ Return the position of the 5’ end of this
GenomicRegionon the reference.Returns: int
-
fix_chromosome(copy=False)¶ Change chromosome representation from chr<NN> to <NN> or vice versa.
Parameters: copy – If True, make copy of region, otherwise will modify existing region in place. Returns: GenomicRegion
-
classmethod
from_string(region_string)¶ Convert a string into a
GenomicRegion.This is a very useful convenience function to quickly define a
GenomicRegionobject from a descriptor string. Numbers can be abbreviated as ‘12k’, ‘1.5M’, etc.Parameters: region_string – A string of the form <chromosome>[:<start>-<end>[:<strand>]] (with square brackets indicating optional parts of the string). If any optional part of the string is omitted, intuitive defaults will be chosen. Returns: GenomicRegion
-
is_forward()¶ Return True if this region is on the forward strand of the reference genome.
Returns: True if on ‘+’ strand, False otherwise.
-
is_reverse()¶ Return True if this region is on the reverse strand of the reference genome.
Returns: True if on ‘-’ strand, False otherwise.
-
ix¶ Region index.
Location in underlying list of regions.
-
overlap(region)¶ Return the overlap in base pairs between this region and another region.
Parameters: region – GenomicRegionto find overlap forReturns: overlap as int in base pairs
-
overlaps(region)¶ Check if this region overlaps with the specified region.
Parameters: region – GenomicRegionobject or string
-
set_attribute(attribute, value)¶ Safely set an attribute on the
GenomicRegionobject.This automatically decodes bytes objects into UTF-8 strings. If you do not care about this, you can also use region.<attribute> = <value> directly.
Parameters: - attribute – Name of the attribute to be set
- value – Value of the attribute to be set
-
strand¶ Strand this region is located on as int.
Returns: 1: forward strand, -1 reverse strand, 0 or None: unknown.
-
strand_string¶ Return the ‘strand’ attribute as string.
Returns: strand as str (‘+’, ‘-’, or ‘.’)
-
three_prime¶ Return the position of the 3’ end of this
GenomicRegionon the reference.Returns: int
-
to_string()¶ Convert this
GenomicRegionto its string representation.Returns: str
-
-
fanc.regions.genome_regions(re_or_file, restriction_enzyme=None)¶ Obtain RE fragments or bins of equal size from a reference genome.
Parameters: - re_or_file – Path to or
RegionBasedfile with regions corresponding to restriction fragments, or path to FASTA file with chromosomes - restriction_enzyme – If the first argument is a FASTA file, you must provide the name of a restriction enzyme here for in silico genome digestion. You can also provide an integer, in which case the genome will be binned into regions of this size in bp.
Returns: RegionsTableof restriction fragments- re_or_file – Path to or